7.4
TITLE: PYROSEQUENCING™ CAN SOLVE SEQUENCING BASED HLA TYPING AMBIGUITIES

Daniel Ramon,1 Yunxia Wang,1 Megan Braden,1 Dina Berchanskiy,1 Xiangjun Liu,1 Lu Wang.1

1Research and Development, Pel–Freez Clinical Systems, Brown Deer, WI

In a sequencing reaction, nucleotide incorporation proceeds simultaneously along all DNA templates. This intrinsic disadvantage leaves the many sequencing based HLA typing (SBT) ambiguities unresolved by sequencing alone. Pyrosequencing™ is a non–gel based, sequencing–by–synthesis method. Each dNTP incorporation event is accompanied by the generation of a proportional amount of visible light. The generation of light is detected in real–time, illustrated as a pyrogram™ peak. The peak height quantifies the number of nucleotides incorporated. In a pyrosequencing™ reaction, nucleotide incorporation proceeds sequentially along each DNA template synchronous to the nucleotide dispensation order (NDO) that is programmed into a pyrosequencer, such as PSQ96. This powerful feature of pyrosequencing™ allows the NDO to be designed to generate pyrograms that are unique for any given allele combination. Here we present that using NDO that results in unique pyrograms from each of the two heterozygous templates, can distinctively resolve SBT ambiguities (see below for one example). This demonstrates that pyrosequencing™ can be used as a primary method for efficient, low ambiguity HLA typing.. DRB1*030115` (317) ACTACTGCAGACACAACTACGGGGTTGTGGAGAGCTTCACA (357) 3` DRB1*110115` (317) CCTACTGCAGACACAACTACGGGGTTGGTGAGAGCTTCACA (357) 3` DRB1*030515` (317) ACTACTGCAGACACAACTACGGGGTTGGTGAGAGCTTCACA (357) 3` DRB1*110415` (317) CCTACTGCAGACACAACTACGGGGTTGTGGAGAGCTTCACA (357) 3` Pel–Freez® is a registered trademark of Pel–Freez Clinical Systems, LLC Pyrosequencing™ and pyrogram™ are trademarks of Pyrosequencing AG